Skip to main content

Table 1 Sequences of primers used for qRT-PCR analysis

From: Overexpression of CsLEA11, a Y3SK2-type dehydrin gene from cucumber (Cucumis sativus), enhances tolerance to heat and cold in Escherichia coli

Primer Sense (5′ → 3′) Antisense (5′ → 3′)
CsLEA11 CGAGCAGTTCCAGCTCTA CTTCCGGTTAACTTCTCCTT
CsActin GAATCCAGCACGATACCA TCAACCCAAAGGCTAACA