Skip to main content

Table 1 Primers used throughout this study and their amplification details

From: The biodiversity of Lactobacillus spp. from Iranian raw milk Motal cheese and antibacterial evaluation based on bacteriocin-encoding genes

Name Sequence (5′ → 3′) Size amplicon Annealing temperature References
Brevicin 174A-F GTCTTAAATGCTAGGCTTGTCA 766 56 Noda et al. (2015)
Brevicin 174A-R CTGGCAAGACAAACGGTTAG
plnA-F TAGAAATAATTCCTCCGTACTTC 573 55 Xie et al. (2011)
PlnA-R ATTAGCGATGTAGTGTCATCCA
plnEF-F TATGAATTGAAAGGGTCCGT 516 54 Xie et al. (2011)
plnEF-R GTTCCAAATAACATCATACAAGG
Pediocin PA-1-F AAAGATACTGCGTTGATAGG 1120 50 Xie et al. (2011)
Pediocin PA-1-R GAGAAGCCATGCTGAAAG
\