Skip to main content

Table 1 Primers used for real-time quantitative PCR

From: NAD+-dependent HDAC inhibitor stimulates Monascus pigment production but inhibit citrinin

Primers Sequence (5′–3′) Fragment length (bp)
MpksCT-F TTTTCAGCGTCGTGGAATAGC 294
MpksCT-R TAACATCTTCGTCGCATCAGC
MpigA-F GTCATTGGCATGTCGTGTAAGG 182
MpigA-R GCATCGTGGTCTCGGATAAAG
GAPDH-F CAAGCTCACTGGCATGTCTATG 243
GAPDH-R AAGTTCGAGTTGAGGGCGATA
  1. F forward primer, R reverse primer