Skip to main content

Table 1 Primers sequences used in the RT-qPCR analyses and sizes of the PCR products obtained

From: Phytohormones and induction of plant-stress tolerance and defense genes by seed and foliar inoculation with Azospirillum brasilense cells and metabolites promote maize growth

Target gene Primer sequences (5′–3′) Amplicon size (pb)
CAT1 CAT1F: ACAGCGATGAGTTGTGACGT 113
CAT1R: ATCCTTGCTGCATCTGTCCG
SOD2 SOD2F: GAGCACCTCAGGATGTTGCT 133
SOD2R: CAGGTGCGCAACATTGTTCA
SOD4 SOD4F: CGTCACCAGCAGGCTAGAAT 139
SOD4R: AGCCAACAGTCCAACACAGT
APX1 APX1F: GATCTTGTGGCTGCAGCATG 111
APX1R: GGTGGACTCGAATTGCAGGA
APX2 APX2F: ACGAAGATGTGATGAACTCAGC 138
APX2R: GGCATTGGCATCGTTAATCAGT
PR1 PR1F: ACTGCAAGCTGATCCACTCC 134
PR1R: TGTTGGTGTCGTGGTCGTAG  
prp2 prp2F: ATTCATCGACGCGTCACAGT 117
prp2R: CAGAGACAAGGACACGGACC
prp4 prp4F: TACGACCACGACACCAACAG 143
prp4R: GCTGCAGATGATGAAGACGC