Skip to main content

Table 2 Gene-specific primers of the lipid metabolism related enzyme

From: Preventing subclinical necrotic enteritis through Lactobacillus johnsonii BS15 by ameliorating lipid metabolism and intestinal microflora in broiler chickens

Gene name Primer sequence (5 → 3) Tm (°C)/size (bp) Accession
ACC F:AATGGCAGCTTTGGAGGTGT
R:TCTGTTTGGGTGGGAGGTG
60.9/136 NM205505
FAS F:CTATCGACACAGCCTGCTCCT
R:CAGAATGTTGACCCCTCCTACC
62.0/107 J03860
SCD1 F:ACCATACATTCCCCTACGACT
R:TTTTCCGGGCCAAGATGACC
56.0/144 NM204890
SREBP-1c F:GAGGAAGGCCATCGAGTACA
R:GGAAGACAAAGGCACAGAGG
60.3/220 AY029224
PPARα F:TGGACGAATGCCAAGGTC
R:GATTTCCTGCAGTAAAGGGTG
60.3/813 AF163809
CPT-1 F:CAATGAGGTACTCCCTGAAA
R:CATTATTGGTCCACGCCCTC
57.5/337 AY675193
ACOX F:ATGTCACGTTCACCCCATCC
R:AGGTAGGAGACCATGCCAGT
54.0/133 NM001006205
PPARγ F:CCAGCGACATCGACCAGTT
R:GGTGATTTGTCTGTCGTCTTTCC
57.5/145 AF163811
ATGL F:TCCTTCACCTTCAGCGTCCA
R:AGTGTTGTCCTCCATCTGGTC
54.0/113 EU852334
LPL F:CAGTGCAACTTCAACCATACCA
R:AACCAGCCAGTCCACAACAA
60.0/150 NM205282
GADPH F:GGTGAAAGTCGGAGTCAACGG
R:CGATGAAGGGATCATTGATGGC
58.4/108 NM204305
  1. ACC acetyl-CoA carboxylase, FAS fatty acid synthase, SCD1 stearoyl-CoA desaturase-1, SREBP-1c sterol regulatory element binding protein-1c, PPARα peroxisome proliferator activated receptor α, CPT-1 carnitine palmitoyltransferase-1, ACOX acyl CoA oxidase, PPARγ peroxisome proliferator activated receptor γ, ATGL adipose triglyceride lipase, LPL lipoprotein lipase, GADPH glyceraldehyde-3-phosphate dehydrogenase