Development of a new method based on unmodified gold nanoparticles and peptide nucleic acids for detecting bovine viral diarrhea virus-RNA

AMB Express

Table 1 PNA probe, primers, and target sequences used in PNA-AuNP colorimetric detection assay, multiplex RT-nPCR, and Real-time RT-PCR

Assay	Name	Sequence (5′ → 3′)	Reference
PNA-AuNP colorimetric detection assay	PNA^a Deleted target Mismatch target	GTACTCAGGGCTT AAAGCCAGTACGT AAGCGCAGTGTAC	This study This study This study
Multiplex RT-nested PCR	Exf Exr Bvdv1 Bvdv2 Ln	AAGATCCACCCTTATGA(A/G)GC AAGAAGCCATCATC(A/C)CCACA TGGAGATCTTTCACACAATAGC GGGAACCTAAGAACTAAATC GCTGTTTCACCCAGTT(A/G)TACAT	Gilbert et al. (1999) Gilbert et al. (1999) Gilbert et al. (1999) Gilbert et al. (1999) Gilbert et al. (1999)
Real-time RT-PCR	Pesti-3F Pesti-4R TQ-Pesti probe	CCTGAGTACAGGRTAGTCGTCA GGCCTCTGCAGCACCCTATCA FAM-TGCYAYGTGGACGAGGGCATGC-BHQ-1	Aebischer et al. (2014b) Aebischer et al. (2014b) Aebischer et al. (2014b)