Skip to main content

Table 1 PNA probe, primers, and target sequences used in PNA-AuNP colorimetric detection assay, multiplex RT-nPCR, and Real-time RT-PCR

From: Development of a new method based on unmodified gold nanoparticles and peptide nucleic acids for detecting bovine viral diarrhea virus-RNA

Assay Name Sequence (5′ → 3′) Reference
PNA-AuNP colorimetric detection assay PNAa
Deleted target
Mismatch target
GTACTCAGGGCTT
AAAGCCAGTACGT
AAGCGCAGTGTAC
This study
This study
This study
Multiplex RT-nested PCR Exf
Exr
Bvdv1
Bvdv2
Ln
AAGATCCACCCTTATGA(A/G)GC
AAGAAGCCATCATC(A/C)CCACA
TGGAGATCTTTCACACAATAGC
GGGAACCTAAGAACTAAATC
GCTGTTTCACCCAGTT(A/G)TACAT
Gilbert et al. (1999)
Gilbert et al. (1999)
Gilbert et al. (1999)
Gilbert et al. (1999)
Gilbert et al. (1999)
Real-time RT-PCR Pesti-3F
Pesti-4R
TQ-Pesti probe
CCTGAGTACAGGRTAGTCGTCA
GGCCTCTGCAGCACCCTATCA
FAM-TGCYAYGTGGACGAGGGCATGC-BHQ-1
Aebischer et al. (2014b)
Aebischer et al. (2014b)
Aebischer et al. (2014b)
  1. a Genome position: 186–198 of NADL-BVDV strain, GenBank: m31182.1