Skip to main content

Table 2 Primers used for PCR amplification

From: Meta-barcoding in combination with palynological inference is a potent diagnostic marker for honey floral composition

Locus Primer name Direction Sequence (5′–3′)
matK KIM3 Forward CGTACAGTACTTTTGTGTTTACGAG
KIM1 Reverse ACCCAGTCCATCTGGAAATCTTGGTTC
rbcL rbcLa Forward ATGTCACCACAAACAGAGACTAAAGC
rbcLajf634R Reverse GAAACGGTCTCTCCAACGCAT
ITS2 ITS2_3 Forward GCATCGATGAAGAACGCAGC
ITS2_4 Reverse TCCTCCGCTTATTGATATGC