Skip to main content
AMB Express

Table 1 Bacterial strains, plasmids, and deoxyoligonucleotide primers

From: Biotransformation of ferulic acid to protocatechuic acid by Corynebacterium glutamicum ATCC 21420 engineered to express vanillate O-demethylase

Bacterial strains, plasmids and deoxyoligonucleotide primers Relevant characteristics or sequences References or source
E. coli
 SCS110 rpsL (Strr) thr leu endA thi-l lacY galK galT ara tonA tsx dam dcm Stratagene
supE44Δ (lac-proAB) [F’traD36 proAB lacl q ZΔM15]  
 Novablue endA1 hsdR17 (rK − mK +) supE44 thi-1 gyrA96 relA1 lac recA1/F’ Novagen
[proAB + lac I q Z ΔM15 Tn10(tet r)]  
C. efficiens
 NBRC 100395 Wild-type C. efficiens, YS314 NBRC
C. glutamicum
 ATCC 13032 Wild-type C. glutamicum, biotin-auxotrophic, l-glutamate producing strain ATCC
 ATCC 21420 C. glutamicum, l-phenylalanine producing strain ATCC
 F C. glutamicum ATCC 21420 derivative harboring pCH Okai et al. (2016)
 FVan C. glutamicum ATCC 21420 derivative harboring pCH-vanABce This study
Plasmids
 pCH E. coli-C. glutamicum shuttle vector with HCE promoter, Kmr Tateno et al. (2007)
 pCH-vanABce pCH containing CE0634-CE0635 (vanAB) from C. efficiens NBRC 100395 This study
Oligonucleotide primers
 CE0634_up300-F tcattgaccgagtactccgttt  
 CE0635_R tcagggcacgtcaattgtcaggtggatatt  
 BglI-CE0634_up300-F CAACAGTTGCGCAGCCTGAATGGCtcattgaccgagtactccgttt  
 BglI-CE0635_R ATAAATCGCATTCGCCATTCAGGCTGATCGCTATTGCCCTCCGATTATTAGGAGGGCGATtcagggcacgtcaattgtcaggtggatatt  
  1. Restriction enzyme cleavage sites are underlined, and the sequences of the primer pairs used for overlap-PCR are in small characters
Back to article page