Skip to main content

TableĀ 2 Primers used for mutant construction and complementation in this study

From: Lsp family proteins regulate antibiotic biosynthesis in Lysobacter enzymogenes OH11

Primer Sequencea Purpose
lsp1-F1 GGGGTACCACGCCCTCGCACGCCTTCGC (KpnI) To amplify a 1072-bp upstream homologue arm of lsp1
lsp1-R1 CCCAAGCTTCATCACCGCCGACGCCAAGT (HindIII)
lsp1-F2 CCCAAGCTTCGGCGAGGGTGAGGGCAAGC (HindIII) To amplify a 638-bp downstream homologue arm of lsp1
lsp1-R2 GCTCTAGACGGCAGCGGATAGCGGAAGT (XbaI)
lsp2-F1 GGGGTACCTTCTGCCCGTGCTGCCTGTT (KpnI) To amplify a 788-bp upstream homologue arm of lsp2
lsp2-R1 CCCAAGCTTCTGGGGCATCGTCGCTGAAG (HindIII)
lsp2-F2 CCCAAGCTTTCGTAGGCGGCGGCGGAGGT (HindIII) To amplify a 875-bp downstream homologue arm of lsp2
lsp2-R2 GCTCTAGACTGCTGTGGGTCGGCGTGCT (XbaI)
lsp3-F1 GGGGTACCTCGCTGGAGTGGGGAGGCAT (KpnI) To amplify a 553-bp upstream homologue arm of lsp3
lsp3-R1 CCCAAGCTTGCGTCGGTGTGCTGCTCAAG (HindIII)
lsp3-F2 CCCAAGCTTCGGCTTCCAGGTAGGTGTAG (HindIII) To amplify a 379-bp downstream homologue arm of lsp3
lsp3-R2 GCTCTAGAGCGGCAACTCCAACAAGACC (XbaI)
lsp1-F GGGGTACCGGTCTCGGCTCGCATCGGTC (KpnI) To amplify a 1275-bp fragment containing intact lsp1 and its predicted promoter
lsp1-R CCCAAGCTTGCGAGCAGAAGCCCGAGTAC (HindIII)
lsp2-F CCCAAGCTTCAAGAAGACCGCCAAGACCG (HindIII) To amplify a 1591-bp fragment containing intact lsp2 and its predicted promoter
lsp2-R GCTCTAGAGACCACCAGGACGGCGAATG (XbaI)
lsp3-F GCTCTAGAAGAATGTCGGCGTCGTCGTC (XbaI) To amplify a 1247-bp fragment containing intact lsp3
lsp3-R GGGGTACCTGGGGCGATGGAAGCAAGGG (KpnI)
Gm-F GTTAGGTGGCGGTACTTGGGTCG To amplify a 500-bp DNA fragment of the gentamycin-resistance gene
Gm-R ATGTTACGCAGCAGCAACGATGT
  1. aRestriction enzyme digestion site are underlined