Skip to main content

Table 2 The oligonucleotide primers used

From: A novel constructed SPT15 mutagenesis library of Saccharomyces cerevisiae by using gTME technique for enhanced ethanol production

Primer names Sequence (5′–3′)a
SPT15-EcoRI-FW CCGGAATTCATGGCCGATGAGGAACGTTTAAAGG
SPT15-SalI-RV CGCTAGGTCGACTCACATTTTTCTAAATTCACTTAGCACA
TAF23-NheI-RV ACTCGAGCTAGCCTAACGATAAAAGTCTGGGCGACCT
TAF23-SalI-FW CGCTAGGTCGACATGGATTTTGAGGAAGATTACGAT
pYX212-FW GGGCAGCATAATTTAGGAG
pYX212-RV AGGGATGTAT CGGTCAGTCA
425-TT-BamHI-FW CGCGGATCCATCCGTATGATGTGCCTGACTA
426-TT-EcoRV-RV AATAAGATATCAGGGAAGAAAGCGAAAGGAG
(MAT-F) AGTCACATCAAGATCGTTTATGG
(MAT-a) ACTCCACTTCAAGTAAGAGTTTG
(MAT-alpha) GCACGGAATATGGGACTACTTCG
  1. aRestriction sites are in italic and underlined