Skip to main content

Table 3 Real-time PCR primers and probes used in this study

From: Autolysis of Pichia pastoris induced by cold

Primer or probea Sequence (5′–3′) Modificationb
Primer
 eng-F (TaqMan MGB) GTCGGTTGACGGGTTAATTGTG None
 eng-R (TaqMan MGB) AGCCGCATAGTCGTAGTAAATCA None
 act1-F (TaqMan MGB) TGTCTGAGCGTGGTTACACTTTT None
 act1-R (TaqMan MGB) CAACGTAACAAAGCTTCTCCTTGAT None
Probe
 eng (TaqMan® probe) CTGCCTTGGCAACTTG FAM/MGB-NFQ
 act1 (TaqMan® probe) CACGGACGATTTCTCT FAM/MGB-NFQ
  1. FAM fluorophore 6-carboxyfluorescein, MGB minor groove binder, NFQ nonfluorescent quencher
  2. a F forward primer, R reverse primer, eng gene encoding a putative endo-β-1,3-glucanase, act1 gene encoding actin 1
  3. bReporter 1 dye/reporter 1 quencher