Skip to main content

Table 3 Nucleic acid sequences of bacterial and novel signal peptides used in this study

From: Novel signal peptides improve the secretion of recombinant Staphylococcus aureus Alpha toxinH35L in Escherichia coli

Signal peptide Nucleic acid sequences (5′ to 3′)
DsbAss ATGAAAAAGATTTGGCTGGCGCTGGCTGGTTTAGTTTTAGCGTTTAGCGCATCGGCG
PelBss ATGAAATACCTGCTGCCGACCGCTGCTGCTGGTCTGCTGCTCCTCGCTGCCCAGCCGGCGATGGCG
PhoAss ATGAAACAAAGCACTATTGCACTGGCACTCTTACCGTTACTGTTTACCCCTGTGACAAAAGCG
NTss ATGAAAACACATATAGTCAGCTCAGTAACAACAACACTATTGCTAGGTTCCATATTAATGAATCCTGTCGCTAATGCC
NSP1 ATGAAATACCTGCTGCCGTGGCTGGCGCTGGCTGGTTTAGTTTTAGCGTTTAGCGCATCGGCG
NSP2 ATGAAAAAGATTACCGCTGCTGCTGGTCTGCTGCTCCTCGCTGCGTTTAGCGCATCGGCG
NSP3 ATGAAAAAGATTTGGCTGGCGCTGGCTGGTTTAGTTTTAGCCCAGCCGGCGATGGCG
NSP3a ATGAAAAAGATTTTAGTTTTAGGTGCTCTGGCGCTGTGGGCCCAGCCGGCGATGGCG
NSP3b ATGAAAAAGATTTGGCTGGCGTTAGTTTTACTGGCTGGTGCCCAGCCGGCGATGGCG
NSP3c ATGAAAAAGATTCTGGCTGGTTGGCTGGCGTTAGTTTTAGCCCAGCCGGCGATGGCG
NSP3d ATGAAAAAGATTTTAGTTTTACTGGCTGGTTGGCTGGCGGCCCAGCCGGCGATGGCG
NSP4 ATGAAAAAGATTACCGCTGCTGCTGGTCTGCTGCTCCTCGCTGCCCAGCCGGCGATGGCG
NSP4a ATGAAAAAGATTCTGCTGCTCCTCGGTACCGCTGCTGCTGCTGCCCAGCCGGCGATGGCG
NSP4b ATGAAAAAGATTCTGCTGCTCCTCCTGCTGCTCCTCCTGCTCGCCCAGCCGGCGATGGCG
NSP4c ATGAAAAAGATTGCTGCTGCTGCTGCGGCGGCGGCGGCTGCGGCCCAGCCGGCGATGGCG
NSP5 ATGAAATACCTGCTGCCGTGGCTGGCGCTGGCTGGTTTAGTTTTAGCCCAGCCGGCGATGGCG
NSP6 ATGAAATACCTGCTGCCGACCGCTGCTGCTGGTCTGCTGCTCCTCGCTGCGTTTAGCGCATCGGCG