Skip to main content

Table 1 Real-time PCR primers used in the relative quantification of ruminal microorganisms

From: Effect of sugarcane fiber digestibility, conservation method and concentrate level on the ruminal ecosystem of beef cattle

Species Sequence (5′–3′) Amplicon size (bp) Reference
F. succinogenes F: GGTATGGGATGAGCTTGC
R: GCCTGCCCCTGAACTATC
445 Tajima et al. (2001)
R. albus F: CCCTAAAAGCAGTCTTAGTTCG
R: CCTCCTTGCGGTTAGAACA
175 Wang et al. (1997)
R. flavefaciens F: TCTGGAAACGGATGGTA
R: CCTTTAAGACAGGAGTTTACA
295 Koike and Kobaiashi (2001)
S. bovis F: CTAATACCGCATAACAGCAT
R: AGAAACTTCCTATCTCTAGG
127 Stevenson and Weimer (2007)
R. amylophilus F: CAACCAGTCGCATTCAGA
R: CACTACTCATGGCAACAT
642 Tajima et al. (2001)
M. elsdenii F: GACCGAAACTGCGATGCTAGA
R: CGCCTCAGCGTCAGTTGTC
129 Ouwerkerk et al. (2002)
Eubacteria F: CCTACGGGAGGCAGCAG
R: ATTACCGCGGCTGCTGG
193 Muyzer et al. (1993)
  1. F forward, R reverse