Skip to main content

Table 1 Strains, plasmids and primers used in this study

From: Designing novel construction for cell surface display of protein E on Escherichia coli using non-classical pathway based on Lpp-OmpA

Strains, plasmids and primers Description Source
Strains
 E. coli DH5α F Φ80lacZΔM15 Δ(lacZYA-argF) U169 recA1 endA1 hsdR17 (rk, mk+) phoA supE44 λ thi 1 gyrA96 relA1 Invitrogen
 E. coli BL21 DE3 FompTgaldcmlonhsdSB(rB-mB-)λ(DE3[lacIlacUV5-T7gene1ind1sam7nin5], expression host Stratagene
 Nontypeable H. influenza ATCC 49766 The source of gene for protein E Pasteur Institute of Iran
Plasmids
 pET-26b T7promoter, an N-terminal pelB signal sequence for potential periplasmic localization, plus optional C-terminal His Tag sequence, kanamycin resistance Novagen
 pET-21b T7promoter, an N-terminal T7 Tag sequence plus an optional C-terminal His Tag sequence, ampicillin resistance Novagen
 pGEM-JR The source of gene for Lpp-OmpA Bioneer
 p21PE Expression vector; Ampr This study
 pPE22-160 Expression vector; Kanr This study
 pLpp-OmpA Expression vector; Kanr This study
 pNon-OmpA Expression vector; Kanr This study
 pLpp-OmpA-PE Expression vector; Kanr This study
 pNon-OmpA-PE Expression vector; Kanr This study
Primers Sequence (5′–3′) Restriction enzymes
EcoRIpE22 GTCAGAATTCAAAGGCTAAACAAAATGATGT EcoRI
HindIIIpE22 GATCAAGCTTTTTTTTATCAACTGAAAATGC HindIII
NcoIpE22 CATGCCATGGATAAGGCTAAACAAAATGATGTG NcoI
PENdeI GGGCATCCATATGAAAAAAATTATTTTAACA NdeI
NonOmpAF CCCATATGAAAGCTACTAAACTGGTACTGGGCAACCCGTATGTTGGCTTTGAAATGGG NdeI
NonOmpAR CGGAATTCGCTCCCGGAATGCCGTTGTCCGGACGAGTGCC EcoRI