Skip to main content

Table 1 Primers used for RT-PCR in this study

From: Thymol and carvacrol induce autolysis, stress, growth inhibition and reduce the biofilm formation by Streptococcus mutans

S. no. Primer name Seq (5′–3′) Gene Product size (~bp)
1 AtlE_F agctggtcccaaaggaaatc AtlE 200
AtlE_R gcctgtgcccaataatcatc
2 AtlA_F ggtttggaggcatcaactgt AtlA 138
AtlA_R agttggttggatatacgcgg
3 Stress_F taagccttacggtgcctttg PnpA 200
Stress_R attaccaacatcgccatcgt
4 GtfB_F gccagccaatgttcatcttt gtfB 160
GtfB_R gaggcatttccccaaatgta
5 YmcA_F gcttttgcaggaacatgaca ymcA 188
YmcA_R tggctcgataatcttggaca
6 SodA39I_F trcaycatgayaarcaccat sodA 400
SodA39J_R arrtartamgcrtgytcccaracrtc
7 16S_895F crcctggggagtrcrg 16S rRNA 200
16S_1100R agggttgcgctcgttg