Skip to main content

Table 1 Real time primers used in the expression studies of various genes involved in the biosynthesis of fumiquinazoline C

From: Epigenetic modifier induced enhancement of fumiquinazoline C production in Aspergillus fumigatus (GA-L7): an endophytic fungus from Grewia asiatica L.

S. no Primer code Primer sequence (5′→3′) No. of base pairs Tm (°C) Use
1 AFGAPDH01-F CACGAACGCTATCGCTC 17 53.4 Amplification of housekeeping GAPDH gene in qPCR study
2 AFGAPDH01-R GCTGGGTATGATATTCTCCG 20 52.4
3 Afua_12040F CCGAGTCTCCCGTCTTCTA 19 55.4 Amplification of Afua_12040 gene
4 Afua_12040R CACTGATTCAGACTGCTGT 19 52.1
5 Afua_12050F CGACTGGAACTGGGTGA 17 54.1 Amplification of Afua_12050 gene
6 Afua_12050R AGACTATTGTCCTGGTGC 18 51.4
7 Afua_12060F ATACTTTGCCCGAGAAGC 18 52.4 Amplification of Afua_12060 gene
8 Afua_12060R TCCGTCTTCGATTGCCTGA 19 56.2
9 Afua_12070F CTTCTGGGCTATCAGGG 17 51.7 Amplification of Afua_12070 gene
10 Afua_12070R GATTCCATCAGATCGAATACCG 22 52.9
11 Afua_12080F GCCAGTAATGGACAGTGTAAG 21 53.1 Amplification of Afua_12080 gene
12 Afua_12080R GGCAGCAGAATATCATGGTT 20 52.9