Epigenetic modifier induced enhancement of fumiquinazoline C production in Aspergillus fumigatus (GA-L7): an endophytic fungus from Grewia asiatica L.

AMB Express

Table 1 Real time primers used in the expression studies of various genes involved in the biosynthesis of fumiquinazoline C

S. no	Primer code	Primer sequence (5′→3′)	No. of base pairs	T_m (°C)	Use
1	AFGAPDH01-F	CACGAACGCTATCGCTC	17	53.4	Amplification of housekeeping GAPDH gene in qPCR study
2	AFGAPDH01-R	GCTGGGTATGATATTCTCCG	20	52.4	Amplification of housekeeping GAPDH gene in qPCR study
3	Afua_12040F	CCGAGTCTCCCGTCTTCTA	19	55.4	Amplification of Afua_12040 gene
4	Afua_12040R	CACTGATTCAGACTGCTGT	19	52.1	Amplification of Afua_12040 gene
5	Afua_12050F	CGACTGGAACTGGGTGA	17	54.1	Amplification of Afua_12050 gene
6	Afua_12050R	AGACTATTGTCCTGGTGC	18	51.4	Amplification of Afua_12050 gene
7	Afua_12060F	ATACTTTGCCCGAGAAGC	18	52.4	Amplification of Afua_12060 gene
8	Afua_12060R	TCCGTCTTCGATTGCCTGA	19	56.2	Amplification of Afua_12060 gene
9	Afua_12070F	CTTCTGGGCTATCAGGG	17	51.7	Amplification of Afua_12070 gene
10	Afua_12070R	GATTCCATCAGATCGAATACCG	22	52.9	Amplification of Afua_12070 gene
11	Afua_12080F	GCCAGTAATGGACAGTGTAAG	21	53.1	Amplification of Afua_12080 gene
12	Afua_12080R	GGCAGCAGAATATCATGGTT	20	52.9	Amplification of Afua_12080 gene