Skip to main content

Table 2 rRNA-targeted oligonucleotide probe used in this study

From: Nitrite oxidizing bacteria (NOB) dominating in nitrifying community in full-scale biological nutrient removal wastewater treatment plants

Probe Specific Sequence (5′–3′) FAa (%) Reference
EUB   GCTGCCTCCCGTAGGAGT   
EUBII Almost all bacteria GCAGCCACCCGTAGGTGT 0–80 Daims et al. (1999)
EUBIII   GCTGCCACCCGTAGGTGT   
Nso1225 Betaproteobacterial ammonia-oxidizing bacteria CGCCATTGTATTACGTGTGA 35 Mobarry et al. (1996)
NEU Most halophilic and halotolerant Nitrosomonas spp. CCCCTCTGCTGCACTCTA 40b Wagner et al. (1995)
NmV Nitrosococcus mobilis TCCTCAGAGACTACGCGG 35 Pommerening et al. (1996)
Cluster6a192 Nitrosomonas oligotropha lineage CTTTCGATCCCCTACTTTCC 35 Adamczyk et al. (2003)
Nsm156 Nitrosomonas spp., Nitrosococcus mobilis TATTAGCACATCTTTCGAT 5 Mobarry et al. (1996)
Nsv443 Nitrosospira spp. CCGTGACCGTTTCGTTCCG 30 Mobarry et al. (1996)
Ntspa712 Phylum Nitrospirae CGCCTTCGCCACCGGCCTTCC 50c Daims et al. (2001)
Ntspa662 Genus Nitrospira GGAATTCCGCGCTCCTCT 35 Daims et al. (2001)
NIT3 Genus Nitrobacter CCTGTGCTCCATGCTCCG 40 Wagner et al. (1996)
  1. a FA formamide
  2. b NEU can also be used with 35% FA
  3. c Ntspa712 can also be used with 35% FA, especially if combined with Ntspa662