Skip to main content

Table 1 Primer sequences used in this study

From: pELMO, an optimised in-house cloning vector

Target Locus (access number) Primer type Name Primer sequence 5′→3′ (added restriction site is underlined) Melting temperature (°C) Expected size (bp)
pDONR-221 ccdB (U51588.1) Encoding gene/colony PCR primer ccdB-ecoRI CGg/aattcAAGCCAGATAACAGTATGCG 60 675
ccdB-pstI AActgca/gACTGGCTGTGTAT
pELMO ccdB (U51588.2) Sequencing primer ccdBsec-F TGCAGTTTAAGGTTTACACC 56 161 bp+ (DNA insert)
ccdBsec-R CACCACCGGGTAAAGTTC
Plasmodium falciparum CSP (XM_001351086) Encoding gene/colony PCR primer F-NCOI c/catggAGTGCTATGGAAGTTCGT 62 246
R-XHO CCGc/tcgagTCATGCATTTGGATCAGGATTAC   
Plasmodium falciparum MSP-1(XM_001352134) Encoding gene/colony PCR primer F-CT CATGc/catggTAGTTGTATTACCCATTTTT 55 512
R-CT CCGc/tcgagTCAGATAACTTTTTTAATTGATTC  
Plasmodium falciparum EBA-175 (XM_001349171) Encoding gene/colony PCR primer F-NCO CATGc/catggTATCCACTAAAGATGTATGTG 54 891
EBARII-Stop CCGc/tcgagTCATCCATCCGTACGAGTTTC
Neospora caninum Nc5 (AY459289.1) Encoding gene/colony PCR primer Np21+ CCCAGTGCGTCCAATCCTGTAGAC 60 350
Np6+  CTCGCCAGTCAACCTACGTCTTCT
Plasmodium vivax ARNP (Pv_Sal1_chr10)-(828,231–828,827) Encoding gene/colony PCR primer PvARNP-D ATGAAAAAAGTGGCCTCGTT 54 597
PvARNP-R AAGGTTGAAGAAAAATTTAAAAA
Plasmodium vivax PvRON4 (KF378614) Encoding gene primer pvron4dir CACAGTGCAACCATGTCTCG 68 ~2300
pvron4rev GCAAGCTAATTTCACAAGTCTTC
Plasmodium vivax PvRON4 (KF378614) Colony PCR primer pvron4intdir CACAGTGCAACCATGTCTCG 60 844
pvron4intrev GCAAGCTAATTTCACAAGTCTTC
pGEM-T easy vector   Sequencing primer SP6 ATTTAGGTGACACTATAG 54 177 bp+ (DNA insert)
T7 AATACGACTCACTATAG
  1. The features for each PCR primer set used in this study