Skip to main content

Table 1 Primer sequences and probes designed in the study

From: Development of a SYBR Green I real-time PCR for the detection of the orf virus

Primer Sequence (5′ → 3′) Genomic position Product length (bp)
F1
R1
CGGAATTCAGTCCGCGAAGAAGTTTTTG
CCCTCGAGGCGAGTCCGAGAAGAATACG
125
622
514
F2
R2
GGGCTCTACTCCACCAACAA
CGAGTCCGAGAAGAATACGC
442
621
180