Skip to main content

Table 1 Primer pairs used for amplification of the monacolin K gene cluster in Monascus

From: Glutamic acid promotes monacolin K production and monacolin K biosynthetic gene cluster expression in Monascus

Genes Primer pairs Length (bp) Tm value
mokA-F 5′- GACCTCGGTCATCTTGGC -3′ 18 59.1
mokA-R 5′- TTGTTCCAAGCGGTCTTC -3′ 18 57.3
mokB-F 5′- AAACATCGTCACCAGTCT -3′ 18 50.7
mokB-R 5′- CTAAGTCGGGCATCTACC -3′ 18 53.1
mokC-F 5′- CAAGCTGCGAAATACACCAAGCCTC -3′ 25 63.6
mokC-R 5′- AGCCGTGTGCCATTCCTTGTTGTCC -3′ 25 65.3
mokD-F 5′- TTCATCTGCTGCTGGTAT -3′ 18 59.8
mokD-R 5′- AACTTCTCACCGTCAATG -3′ 18 58.7
mokE-F 5′- ATCGCAGGTCACGCACATCCAAGTC -3′ 25 72.3
mokE-R 5′- GTAAAGGCAGCCCGAGCAGCTTCAT -3′ 25 71.1
mokF-F 5′- GAGATCATAGTGGCCGACTGAA -3′ 22 59.8
mokF-R 5′- ACCGTCTCATCCAACCTCACGA -3′ 22 56.1
mokG-F 5′- CCAGGTAACCAACGGATTA -3′ 19 56
mokG-R 5′- GATCAGAGCAGTCACCAG -3′ 18 52
mokH-F 5′- CAGGAAATCTGGACTTACCCCATTG -3′ 25 65.8
mokH-R 5′- TGTTGGATTGTTGTTGGAGATATAC -3′ 25 59.2
mokI-F 5′- ATGTTGAATGGCAATGATGG -3′ 20 60.9
mokI-R 5′- CAGCGTGGGTGATGTATC -3′ 18 61.7
GAPDH-F 5′- CCGTATTGTCTTCCGTAAC -3′ 19 55.4
GAPDH-R 5′- GTGGGTGCTGTCATACTTG -3′ 19 57.6