Skip to main content

TableĀ 1 Primers used for PCR amplification of the xylanases genes

From: Xylanases of Cellulomonas flavigena: expression, biochemical characterization, and biotechnological potential

NCBI reference sequence

Forward primer

Reverse primer

WP_013115499.1

GGTACCGGATCCCAGAACGTCAGCAGC

CTGCAGAAGCTTTCAGGAGCAGATGCC

WP_013115627.1

GTACCGGATCCGCTCCCGCTCACG

CTGCAGAAGCTTTCACCCGACCTTCACG

WP_043598780.1

CGCGGATCCGCGGTCGCCGAGAC

CCCAAGCTTTCACGACCTCGGCCTG

WP_013118747.1

CGCGGATCCACGTCCCCCACGCC

CCCAAGCTTTTACTCGCCGGCCAGC

WP_013118731.1

CGCGGATCCGCGGGCAGCACGC

CCCAAGCTTTCAGGAGGCCGTGCAG

WP_013117551.1

TACGGATCCGCGCCGGGCTGGTC

CTGCAAGCTTTCAGCGCGGCCGCG

WP_013117277.1

TACGGATCCATGACCGCCCAGCCGATC

CTGCAAGCTTTCATCGCGCGGCCACG

WP_013118238.1

TACGGATCCGCGGAGAGCACGCTCG

CTGCAAGCTTCTACCGCTGCAGCGTCA

WP_043598750.1

TACGGATCCGCGGACCCCGTGAGC

CTGCAAGCTTTCAGCGCCGCAGCAG

WP_052302667.1

TACGGTACCATGGTCGGGACGACCCTG

CTGCAAGCTTTCAGCGCCAGACGACCA