Skip to main content

TableĀ 1 Primers used for PCR amplification of the xylanases genes

From: Xylanases of Cellulomonas flavigena: expression, biochemical characterization, and biotechnological potential

NCBI reference sequence Forward primer Reverse primer
WP_013115499.1 GGTACCGGATCCCAGAACGTCAGCAGC CTGCAGAAGCTTTCAGGAGCAGATGCC
WP_013115627.1 GTACCGGATCCGCTCCCGCTCACG CTGCAGAAGCTTTCACCCGACCTTCACG
WP_043598780.1 CGCGGATCCGCGGTCGCCGAGAC CCCAAGCTTTCACGACCTCGGCCTG
WP_013118747.1 CGCGGATCCACGTCCCCCACGCC CCCAAGCTTTTACTCGCCGGCCAGC
WP_013118731.1 CGCGGATCCGCGGGCAGCACGC CCCAAGCTTTCAGGAGGCCGTGCAG
WP_013117551.1 TACGGATCCGCGCCGGGCTGGTC CTGCAAGCTTTCAGCGCGGCCGCG
WP_013117277.1 TACGGATCCATGACCGCCCAGCCGATC CTGCAAGCTTTCATCGCGCGGCCACG
WP_013118238.1 TACGGATCCGCGGAGAGCACGCTCG CTGCAAGCTTCTACCGCTGCAGCGTCA
WP_043598750.1 TACGGATCCGCGGACCCCGTGAGC CTGCAAGCTTTCAGCGCCGCAGCAG
WP_052302667.1 TACGGTACCATGGTCGGGACGACCCTG CTGCAAGCTTTCAGCGCCAGACGACCA