Skip to main content

Table 1 Oligonucleotide primers used for the construction of expression plasmids

From: Production of (R)-3-hydroxybutyric acid by Arxula adeninivorans

Designation Oligonucleotide sequence Source
ORFs primers Eurofins-Genomics
 Akat1_start_MunI TAGACAATTGATGGACAGACTCAACAACGTAGC
 Akat1_stop_BamHI GCAAGGATCCTTACTCCCGGATAAACAGAGC
 Akat2_start_BamHI TAGAGGATCCATGGAAAGAGCATCTAATCTTGCC
 Akat2_stop_NotI GCAAGCGGCCGCCTACTCCCTAATGAAGAGCG
 Akat4_start_EcoRI TAGAGAATTCATGTCTGTTTATATTCTTAGTGCTAAG
 Akat4N10_start_EcoRI TAGAGAATTCATGACACCCATTGGTTCGTTTTTGGG
 Akat4 N17_start_EcoRI TAGAGAATTCATGGGATCTCTGTCTTCTCAGAC
 Akat4_stop_BamHI GCAAGGATCCTCAAACTCTCTCAATTACAAGAGC
 Atpk2_start_BamHI GCAAGGATCCATGCTACGACGGGGAATTC
 Atpk2_stop_NotI TAGCGGCCGCTCACAACTTTGCCCCAGC
 Afox2_start_EcoRI TAGAGAATTCATGTCGGTGCCAACGGC
 Afox2_stop_NotI TAGCGGCCGCTTAAAGCTTGGCTCCTCCG
Two-step cloning
 TEF1_SpeI TATAACTAGTTAGTAGCGCTAATCTATAATCAG
 PHO5_BsiWI CGGACGTACGAGCTTGCATGCCTGCAGA
 TEF1_SpeI_BsiWI TATACTAGTACTTCGTACGCTCGACTTCAATCTATAATCAGTC
 PHO5_SacII_MluI GGATCCGCGGCCGAACGCGTAGCTTGCATGCCTGCAGATTTTAATC
  1. Restriction sites were designated in italic