Skip to main content

Table 1 Primers used in this work

From: Expression, purification and functionality of bioactive recombinant human vascular endothelial growth factor VEGF165 in E. coli

DNA used Primers
pGEMT easy vector Universal 5′GTTTTCCCAGTCACGACGTTGTA3′
Reverse 5′AGCGGATAACAATTTC3′
cDNA F (ex2) 5′GGATCCGCACCCATGGCAGAAGGAGGA
R (ex8) 5′CTCGAGTCAGTGGTGGTGGTGGTGGTGCCGCCTCGGCTTGTCACATCT