Skip to main content

Table 1 Relation of primers for the candidate genes to internal control

From: Validation of reference genes for normalization of gene expression by qRT-PCR in a resveratrol-producing entophytic fungus (Alternaria sp. MG1)

Internal gene Gene name Primer sequence (5′–3′)
Forward/reverse
Amplicon length (bp) Amplification efficiency (%) Regression coefficient (R 2) Accession number at GenBank
ACTB β-Actin CAAGACGGAAGGCTGGAA/
CACTGCCGAGCGAGAAAT
195 100.4 0.997 GEMY01018051
EF1 Elongation factor 1 CACTGGTTTTGCCTTTTCCT/
TGTGGGCACCGTCAAAGT
186 127.3 0.995 GEMY01015044
EF2 Elongation factor 2 ATAACAGCCTGGAAGATGC/
CTTTCACCATCCGTCAGTT
207 98.3 0.996 GEMY01001243
RPS5 Ribosomal protein S5 ACACCCATACAAAGAACG/
CCGAGTGCCTTGCTGA
131 104.1 0.985 GEMY01011888
RPS24 Ribosomal protein S24 CCGTCTTGTCGTTCCC/
CGATTGGCGGTTTCTC
133 104.8 0997 GEMY01015522
TUBA α-Tubulin CAAGCGAGTCAGAAGC/
GGTATGTTGGTGAGGGTAT
101 106.9 0.984 GEMY01012167
UBC Ubiquitin-conjugating enzyme GGCTCAAGAAACAGGAA/
AGATTTACCACCCGAAC
123 100.4 0.984 GEMY01016137
UFD Ubiquitin fusion degradation protein TCCTCCTTGCCCTTGA/
CGAATCCGCCTCCTAC
108 123.6 0.996 GEMY01001986
18S 18S ribosomal RNA TCTTGTTTCCTTGGTGGGT/
GCATTTCGCTGCGTTCT
144 106.2 0.980 JN102357.1