Effect of textile dyes on activity and differential regulation of laccase genes from Pleurotus ostreatus grown in submerged fermentation

AMB Express

Table 1 Primer sequence, product length and amplification efficiencies used in this study

Gene	Transcript ID^a	Orientation^b	Sequence (5′–3′)	Product size (bp)	Efficiency (%)
poxa1b	1113032	Fw	GGCGACAGGTTCCAAATTA	101	2.23
poxa1b	1113032	Rv	TTGTGTCCCTTGACGAAGAG	101	2.23
pox2	1089723	Fw	CTGGCGTTCTCGTTCAAG	87	2.12
pox2	1089723	Rv	TCGTCTTCAACATAGTCGTGTCT	87	2.12
pox3	1077328	Fw	TCACCATTCGCTTTGTCACT	100	2.14
pox3	1077328	Rv	TTCTCAGCCAATACGACAGC	100	2.14
pox4	1043420	Fw	TACTCGTTCGTGTTGAAGGC	131	2.27
pox4	1043420	Rv	GCATTGGGTGCTAGGATGTA	131	2.27
gpd	1090672	Fw	GCTGACGCACCAATGTTC	83	2.00
gpd	1090672	Rv	GTGCAAGACGCATTTGAG	83	2.00

^aTranscript ID and gene nomenclature refer to the annotation of P. ostreatus PC15 genome version 2.0 (http://www.genome.jgi-psf.org/PleosPC15_2/PleosPC15_2. home.html)
^b Fw forward; Rv reverse