Skip to main content

Table 1 Primer sequence, product length and amplification efficiencies used in this study

From: Effect of textile dyes on activity and differential regulation of laccase genes from Pleurotus ostreatus grown in submerged fermentation

Gene Transcript IDa Orientationb Sequence (5′–3′) Product size (bp) Efficiency (%)
poxa1b 1113032 Fw GGCGACAGGTTCCAAATTA 101 2.23
Rv TTGTGTCCCTTGACGAAGAG
pox2 1089723 Fw CTGGCGTTCTCGTTCAAG 87 2.12
Rv TCGTCTTCAACATAGTCGTGTCT
pox3 1077328 Fw TCACCATTCGCTTTGTCACT 100 2.14
Rv TTCTCAGCCAATACGACAGC
pox4 1043420 Fw TACTCGTTCGTGTTGAAGGC 131 2.27
Rv GCATTGGGTGCTAGGATGTA
gpd 1090672 Fw GCTGACGCACCAATGTTC 83 2.00
Rv GTGCAAGACGCATTTGAG
  1. aTranscript ID and gene nomenclature refer to the annotation of P. ostreatus PC15 genome version 2.0 (http://www.genome.jgi-psf.org/PleosPC15_2/PleosPC15_2. home.html)
  2. b Fw forward; Rv reverse