Skip to main content

Table 1 Oligonucleotide primers used for RT-qPCR techniques

From: Relative significances of pH and substrate starch level to roles of Streptococcus bovis S1 in rumen acidosis

Items Sequence of primers (5′-3′) Reference GeneBank ID Production Amplification efficiency (%)
16S F:GAACACCGGTGGCGA (Asanuma et al. 2010)    97.13
  R:CTCATCGTTTACGGCG     
PFL F:GGTTACATCTACGACTACGA This study AB014686.1 119 98.54
  R:TGGCTACGAAGACGAGTA     
LDH F:GGTTCTTCTTACGCATTCG This study U60997.1 190 99.67
  R:TAACTACAAGGTCAGCATCT     
α-AMY F:TCAAGCACTGGAATCAACTA This study U04956.1 109 101.12
  R:GCCGTAATAATCTCCGTAGA     
CCPA F:CCGTTGGTGTTGTTATTCC This study AB028599.3 126 95.24
  R:TATCGTCGTCTTCATCACTT