Skip to main content

Table 2 Primers used for real-time PCR

From: Screening of genes involved in interactions with intestinal epithelial cells in Cronobacter sakazakii

Gene Primer name Primer sequence Product size (bp)
recB AFK64_02315 F CAGGATACCGACCCGCAACA 116
AFK64_02315 R TTTATGCGTTTCGCGGTGC
bglF AFK64_20760 F CGGCATCAGCATGTCATAG 139
AFK64_20760 R CTTTAGTGTCTCGGCGAGTTT
fnr AFK64_08415 F AATCCCGTTCGAGACGTTAG 104
  AFK64_08415 R TCATATCCTGGTCGCCTTTG
flhA AFK64_06715 F CGCATCCGCAGTATCCGTAA 129
AFK64_06715 R GCCGATTTCCACGCCTTTC
fliR ESA_02516 F CAATCTTGACGCGGATGCTAA 102
ESA_02516 R ACTGGCTGACTCTGTACTTCTGG
hp-1 a AFK64_01330 F GTTTCATATTCTTCGAGCTTTGG 119
AFK64_01330 R TTGCCCGACAATCTTGTGCC
hp-2 a ESA_04202 F CTCAGCCGGGTGTTTTCACT 106
ESA_04202 R GCGCTAATTCTGCCAGCAA
hp-3 a ESA_00132 F CGTTTTACGGGCTTGTCTGT 104
ESA_00132 R ACCGCCTGGCAATAAATCA
16S rDNA 16S F ACCCGCAGAAGAAGCAC 148
16S R GCAGTTCCCAGGTTGAG
  1. a hp-1, hp-2 and hp-3 indicate the three hypothetical proteins coding genes