Skip to main content

Table 1 Primers used in this study

From: Kinetic properties and stability of glucose dehydrogenase from Bacillus amyloliquefaciens SB5 and its potential for cofactor regeneration

No. Primer Sequence
1 gdh-bs-F-BamHI 5′CCGGATCCATGTATCCGGATTTAAAAGGAA3′
2 gdh-ba-F-BamHI 5′CCGGATCCATGTACACGGATTTAAAAGGAA3′
3 gdh-R-KpnI 5′CTGGTACCTTATCCGCGGCCTG3′
4 gdh-ba-F-NdeI-His 5′CGCCATATGCACCACCACCACCACCACTACACGGATTTAAAAGGAAAAG3′
5 gdh-R-XhoI 5′CCGCTCGAGTTATCCGCGGCCTGCCTGGAATG3′
6 gdh-bs-F-BsrGI 5′CCTGTACAATGTATCCGGATTTAAAAGGAA3′
7 gdh-ba-F-BsrGI 5′CCTGTACAATGTACACGGATTTAAAAGGAA3′
  1. Restriction sites are underlined