Skip to main content

Table 2 List of primers used in this study

From: Metabolic engineering of the mixed-acid fermentation pathway of Escherichia coli for anaerobic production of glutamate and itaconate

Name and description Sequence
For icd deletion
 icd flank F CCCGTTAATAAATTTAACAAACTACGGCATTACATGTTTTCGATGATCGCTGTAGGCTGGAGCTGCTTCG
 icd flank R AACGTGGTGGCAGACGAGCAAACCAGTAGCGCTCGAAGGAGAGGTGAATGATTCCGGGGATCCGTCGACC
For PCR verifications
 icd check F ACGTGGTGGCAGACGAGCAAAC
 icd check R TTAATAAATTTAACAAACTACGG
 pACYC MCS1 F GGATCTCGACGCTCTCCCT
 pACYC MCS1 R GATTATGCGGCCGTGTACAA
Sequencing
 icd200seqF GGATCACACGCGTGGGCTG
 icd200seqR GGTGTAAGGAGTGGTAATTCA
  1. The 50 bp targeting flanks are underlined