Skip to main content

Table 2 Primers used in the present study

From: Engineering of Saccharomyces cerevisiae for the production of poly-3-d-hydroxybutyrate from xylose

Name Amplification target Sequence (5‘ to 3’)
TEF1p_f S. cerevisiae TEF1 promoter CTAGAGGATCCCCGGGTATAGCTTCAAAATGTTTCTAC
TEF1p_r CACGTCAGTCATTTTGTAATTAAAACTTAGATTAG
PhaA_f Codon optimized PhaA ORF from C. necator GTTTTAATTACAAAATGACTGACGTGGTGATTG
PhaA_r CACGTCAGTCATTTTGTAATTAAAACTTAGATTAGATTG
TEF1t_f S. cerevisiae TEF1 terminator GTTGAAAGAAAGTAAGGAGATTGATAAGACTTTTC
TEF1t_r GATATAGAGCTCAGATAGCGCCGATCAAAG
TPI1p_f S. cerevisiae TPI1 promoter TCTGAGCTCTATATCTAGGAACCCATCAG
TPI1p_r CAATCCTTTGCGTCATTTTTAGTTTATGTATGTGTTTTTTG
PhaB1_f Codon optimized PhaB1 ORF from C. necator CATACATAAACTAAAAATGACGCAAAGGATTGCGTATG
PhaB1_r GATAATATTTTTATATAATTATATTATTAACCCATGTGTAAGCCAC
TPI1t_f S. cerevisiae TPI1 terminator CACATGGGTTAATAATATAATTATATAAAAATATTATCTTCTTTTC
TPI1t_r CTAACTAGTTATATAACAGTTGAAATTTGGATAAG
GPM1p_f S. cerevisiae GPM1 promoter TATATAACTAGTTAGTCGTGCAATGTATGAC
GPM1p_r CTTTACCAGTGGCCATTATTGTAATATGTGTGTTTGTTTG
PhaC1_f Codon optimized PhaC1 ORF from C. necator CATATTACAATAATGGCCACTGGTAAAGG
PhaC1_r CATTCATTCTTCAGACTTATGCCTTTGCTTTCACATAC
GPM1t_f S. cerevisiae GPM1 terminator GAAAGCAAAGGCATAAGTCTGAAGAATGAATGATTTG
GPM1t_r TACCGCATCAGGCGCCATATTCGAACTGCCCATTCAG