Skip to main content

Table 2 Primers used in the present study

From: NADH-dependent biosensor in Saccharomyces cerevisiae: principle and validation at the single cell level

Name Description Sequence
TRP1_gpd1Over_f Forward primer for amplification of TRP1 (p424 as template) with GPD1 overhangs TCCACAAACACAAATATTGATAATATAAAGAACGACATTACTATATATATAATATAG
TRP1_gpd1Over_r Reverse primer for amplification of TRP1 (p424 as template) with GPD1 overhangs AGTATGATATGTTATCTTTCTCCAATAAATAGGCAAGTGCACAAACAATAC
TRP1_gpd1_veri_f Amplification of the 5' region of GPD1 (CEN.PK113-7D as template) TTCCATTCACATATCGTCTTTGG
+ Verification of GPD1 deletions
5-OEGpd1_r Amplification of the 5' region of GPD1 (CEN.PK113-7D as template) TATATTATCAATATTTGTGTTTGTGG
3-OEGpd1_f Amplification of the 3' region of GPD1 (CEN.PK113-7D as template) TTTATTGGAGAAAGATAACATATCATAC
3-OEGpd1_r Amplification of the 3' region of GPD1 (CEN.PK113-7D as template) ATTTTCTTAGGACGCCGCAAAATATC
TRP1_gpd1_veri_r Verification of GPD1 deletions GAGGAACTCTTGGTATTCTTGCC
LEU2_gpd2Over_f Forward primer for amplification of LEU2 (p425 as template) with GPD2 overhangs TTCCTTTTCCTTCGCTCCCCTTCCTTATCATCGACTACGTCGTAAGGCCG
LEU2_gpd2Over_r Forward primer for amplification of LEU2 (p425 as template) with GPD2 overhangs GATCAGAGGGGGAGGGGGGGGGAGAGTGTCGAGGAGAACTTCTAGTATATC
LEU2_gpd2OO_f Forward primer for nested PCR for adding homology regions to the GPD2 deletion casette GTATTTTGGTAGATTCAATTCTCTTTCCCTTTCCTTTTCCTTCGCTCCC
LEU2_gpd2OO_r Reverse primer for nested PCR for adding homology regions to the GPD2 deletion casette AAATTGGTTGGGGGAAAAAGAGGCAACAGGAAAGATCAGAGGGGGAGGG
LEU2_gpd2_veri_f Verification of GPD2 deletions CGTGTATCTTCTAAGATTCAGTC
LEU2_gpd2_veri_r Verification of GPD2 deletions CTAATGGCTCAACGTGATAAGG
GPD2p_XbaI_r Cloning of GPD2 from CEN.PK113-7D CTTCTAGATTGATAAGGAAGGGGAG
GPD2p_SacI_f Cloning of GPD2 from CEN.PK113-7D TCGAGCTCCGCAATGTTTCGTTGG
yEGFP_XbaI_f Cloning of yEGFP3 from pyEGFP3 AATCTAGAAGCATTAAAAAATGTCTAAAGGTGAAG
yEGFP_PstI_r Cloning of yEGFP3 from pyEGFP3 TTCCTGCAGAGTTATTTGTACAATTCATCCATAC
HIS3_flank_f Cloning of HIS 3 - Forward primer CCAGGTATCGTTTGAACACGG
HIS3_flank_r Cloning of HIS 3 - Reverse primer GCTCAGTTCAGCCATAATATG
LEU2_flank_f Cloning of LEU2 - Forward primer GGATAATTATACTCTATTTCTCAAC
LEU2_r Cloning of LEU2 - Reverse primer TTAAGCAAGGATTTTCTTAAC
TRP1_f Cloning of TRP1 - Forward primer ATGTCTGTTATTAATTTCAC
TRP1_r Cloning of TRP1- Reverse primer CTATTTCTTAGCATTTTTG
YIplac211_f Cloning of GPD2 p-yEGFP3-PGK 1t TTTATCTTCGTTTCCTGC
YIplac211_r Cloning of GPD2 p-yEGFP3-PGK1 t AAAACTGTATTATAAGTAAATG
HIS3_O_f Cloning of HIS3- expression cassette, for change of auxotrophic marker. TTATAATACAGTTTTCCAGGTATCGTTTGAACACGG
HIS3_O_r Cloning of HIS3-expression cassette, for change of auxotrophic marker. GGAAACGAAGATAAATCGCTCAGTTCAGCCATAATATG