Skip to main content

Table 1 Sequence of each DNA oligonucleotide used in this study

From: The use of nano-sized acicular material, sliding friction, and antisense DNA oligonucleotides to silence bacterial genes

Strain Target gene Name of antisense oligonucleotide Accession no. Position Sequence of antisense oligonucleotide DNA (5′-3′) Length of antisense oligonucleotide DNA (bp)
Escherichia coli JM109 (pUC18) β-lactamase (bla) B-LAC15 L08752 876-891 ACTCAT ACTCTTCCT 15
   B-LAC90   851-940 AGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCAT ACTCTTCCTTTTTCAATATTATTGAAGCATTTAT 90
  β-galactosidase (lacZα) LacZ15   221-207 GGTCAT AGCTGTTTC 15
   LacZ90   185-274 CTGCAGGTCGACTCTAGAGGATCCCCGGGTACCGAGCTCGAATTCGTAATCATGGTCAT AGCTGTTTCCTGTGTGAAATTGTTATCCGCT 90
Pseudomonas pseudoalcaligenes KF707 Hydrolase (bphD) BphD15 X66123 178-164 GTGCGGTCAT TTTTC 15
   BphD90   231-142 GGTAGAACTTTCGGTGAGTGCGGTCAT TTTTCATCCTTTAAGTGAGTGGAGTGGAAACTGGTCAGGCGCAGCGCTTCATGCCGCGCCGGG 90
Bacillus subtilis str.168 Sporulation initiation protein (spo0A) Spo0A15 AL009129 2518821-2518835 CTCCAC GTTTCTTCC 15
   Spo0A90   2518768-2518857 CTTAACAGGCTTACCAGCTCTCGATTATCATCAGCAACACAAACTTTAATTTTCTCCAC GTTTCTTCCTCCCCAAATGTAGTTAACAGGA 90
  1. Bold italic letter indicates sequence complementary to the translation codon (AUG or GUG) in a target mRNA.