Skip to main content

Advertisement

Table 1 Primers used in this research

From: Deletion of glucose oxidase changes the pattern of organic acid production in Aspergillus carbonarius

Name Sequence (5’ → 3’) Annotation
Gox upU Fw GGGTTTAAU TCTCCTTGTGCTGACCAACCG USER cloning of gene gox upstream
Gox upU Rv GGACTTAAU GTTTACCAATCCCGCCGCGTC USER cloning of gene gox upstream
Gox downU Fw GGCATTAAU AGGTGAGATGGAGTTGTTG USER cloning of gene gox downstream
Gox downU Rv GGTCTTAAU TTGGGATGGGTAGGGTATT USER cloning of gene gox downstream
Gox Fw1 GCCCTGCCACACTACATCCG Amplify internal sequence of gene gox
Gox Rv1 TCGCCACAGCCGAGATCCTT Amplify internal sequence of gene gox
Gox Fw2 GCTGCCAATCCTTCGGTCCA Amplify internal sequence of gene gox
Gox Rv2 TAGTCGCCAAAGGTCTCGTT Amplify internal sequence of gene gox
Gox Fw3 AACAACCTCACCCACCAGAG Amplify the sequence containing gene gox
Gox Rv3 ACCATTGAAGTGGCAGGAAC Amplify the sequence containing gene gox