Name | Sequence (5’ → 3’) | Annotation |
---|---|---|
Gox upU Fw | GGGTTTAAU TCTCCTTGTGCTGACCAACCG | USER cloning of gene gox upstream |
Gox upU Rv | GGACTTAAU GTTTACCAATCCCGCCGCGTC | USER cloning of gene gox upstream |
Gox downU Fw | GGCATTAAU AGGTGAGATGGAGTTGTTG | USER cloning of gene gox downstream |
Gox downU Rv | GGTCTTAAU TTGGGATGGGTAGGGTATT | USER cloning of gene gox downstream |
Gox Fw1 | GCCCTGCCACACTACATCCG | Amplify internal sequence of gene gox |
Gox Rv1 | TCGCCACAGCCGAGATCCTT | Amplify internal sequence of gene gox |
Gox Fw2 | GCTGCCAATCCTTCGGTCCA | Amplify internal sequence of gene gox |
Gox Rv2 | TAGTCGCCAAAGGTCTCGTT | Amplify internal sequence of gene gox |
Gox Fw3 | AACAACCTCACCCACCAGAG | Amplify the sequence containing gene gox |
Gox Rv3 | ACCATTGAAGTGGCAGGAAC | Amplify the sequence containing gene gox |