Skip to main content

Advertisement

Table 1 Oligonucleotides used during the study

From: Erythritol production on wheat straw using Trichoderma reesei

Name Sequence (5’ – 3’) Usage
pbxl1_SalI__EcoRI_f ATATAGTCGACGAATTCAGCTTGTCTGCCTTGATTACCATCC Vector construction
pbxl1_XbaI_r ATATATCTAGATGCGTCCGGCTGTCCTTC Vector construction
err1_XbaI_f ATATATCTAGAATGTCTTCCGGAAGGACC Vector construction
err1_Nsi_r TATATATGCATTTACAGCTTGATGACAGCAGTG Vector construction
ppki_f GCACGCATCGCCTTATCGTC PCR test
qerr1_f CTTTACCATTGAGCACCTCGACG RT-qPCR
qerr1_r GGTCTTGCCCTGCTTCTTGG RT-qPCR
qact1_f TGAGAGCGGTGGTATCCACG RT-qPCR
qact1_r GGTACCACCAGACATGACAATGTTG RT-qPCR
qsar1_f TGGATCGTCAACTGGTTCTACGA RT-qPCR
qsar1_r GCATGTGTAGCAACGTGGTCTTT RT-qPCR