Skip to main content

Table 1 Summary of nucleotide primers used in this study

From: Xylanase (GH11) from Acremonium cellulolyticus: homologous expression and characterization

Primer Nucleotide sequence (5’ → 3’)
For plasmids construction  
AC-F12 (xylA) ATTGTTAACAAGATGAAGATCACATCAGTGTTCG
AC-R12 (xylA) AATCCTGCAGGTTAAGATACAGTAACAGTGGCACTTC
AC-F13 (xylB) ATTGTTAACATCATGGGCATCTCATCTATTCTTC
AC-R13 (xylB) AATCCTGCAGGCTATTGGCACTGACTGTAGTAAGCGT
AC-F25 (xylC) ATTGTTAACAAGATGAAGCTCTCTCTGGCTGCAA
AC-R25 (xylC) AATCCTGCAGGCTAGGACACGGTGATGGTACTAGAAC
AC-F26 (xylD) ATTGTTAACAAGATGCGGTCATTTGCTCGCCTTGTC
AC-R26 (xylD) AATCCTGCAGGTCAGCTAACAGTAAAATCCAGGTAAC
AC-F27 (xylE) ATTGTTAACAAGATGATTTATTTCCCTCAGCTCATG
AC-R27 (xylE) AATCCTGCAGGCTATTGAGTGGCAGTCTGCTGGGCA
AC-F28 (xylF) ATTGTTAACAAGATGTTCTCTTTCAGTACTGCCTT
AC-R28 (xylF) AATCCTGCAGGCTACAAGCATTGATAGTAGTACGGGT
AC-F29 (xylG) ATTGATATCAAGATGGTTGCTTTCTCGAGCTTATTTAC
AC-R29 (xylG) AATCCTGCAGGGTCCAACATCAATGCTACTTACAGC
For quantitative PCR  
xylA-f GAGGACGGAGTCAATGGAGA
xylA-r CCGAGAGGTAGGAGCCAGAA
xylB-f TGCTCTCGGTGTTGATGTTG
xylB-r GTGGTCTGGTAGTCGGTGGA
xylC-f GTGTCGACCAACCCTCCATC
xylC-r GTCCAAGTGCCTTCCATGCT
xylD-f TTTAGCGATAGCGGCAGGTT
xylD-r CCCATGTAAGGGAGCGAGTT
xylE-f CGGGCCACAAACTATATCCA
xylE-r TTCCAGCCAACACCAACAAC
xylF-f ACTAGCAAGGACGGCGTAGA
xylF-r CACCGAGGAACTCAGACGAA
xylG-f CAGCACGGGGTTTGAGGTT
xylG-r CCGAAGTTGATGGGAGTGGT
gpdA-f AACATCATTCCCAGCAGCAC
gpdA-r CGGCAGGTCAAGTCAACAAC