Skip to main content

Table 2 Oligonucleotide primers

From: Disruption of pknG enhances production of gamma-aminobutyric acid by Corynebacterium glutamicum expressing glutamate decarboxylase

Primer name Sequence (5′- 3′) Restriction enzyme
pknG-up-In-F GCCAAGCTTgcatgcATGAAGGATAATGAAGATTTCGATCCAGATTCACCAGC Sph I
pknG-up-In-R-801 ACCATTTGTGTCGCC GGCTTTGCAGCGGTCTTTCAGGGA  
pknG-down-In-F-1669 GCCAAGCTTgcatgcGGCGACACAAATGGT TCTCCG Sph I
pknG-down-In-R AAAAGGATCggatccCTAGAACCAACTCAGTGGCCGCA Bam HI
pknG-In-F2 CCAGTGCCAAGCTTgcatgcATGAAGGATAATGAAGATTTCGATCCAGATTCACCAGC Sph I
pknG-In-R2 AAAAAGGATCggatccCTAGAACCAACTCAGTGGCCGCA Bam HI
SacI-gadB-F GGCgagctcATGTTTAAAGCTGTTCTGTTGGGCAA Sac I
XhoI-gadBF-R CCGctcgagTTACTTGTCATCGTCATCCTTGTAGTCAGGTCGGAACTACTCGATTCACG Xho I
  1. Restriction enzyme cleavage sites are shown in small letters, and complementary sequences of the primer pairs used for overlap-extension PCR are shown in italics.