Skip to main content

Table 1 Oligonucleotide primers used for PCR amplifications in this study

From: Evaluation of the food grade expression systems NICE and pSIP for the production of 2,5-diketo-D-gluconic acid reductase from Corynebacterium glutamicum

Primer name Restriction enzyme c Sequence (5′-3′) Target gene
V1a - ATGGATCAGAAGAATAAGCTTTC dkr
V2b Spe I TCTACGACTAGT TCAGTTCAGATCATTCGG dkr
V3b Xho I CTATCGCTCGAG TCAGTTCAGATCATTCGGG dkr
P1a Spe I CGGAAATCACGGGAACTAGT CGCCAAA P sppA , P sppQ
P2b - CGGTACCTACAACAGACATGGGAATCATACTCCTATATATTATT P sppA
P3b - CGGTACCCACAACAGACATATATGCTGGCCAGCTAAGTA P sppQ
  1. a forward primer.
  2. b reverse primer.
  3. c restriction sites are underlined.