Skip to main content

Table 1 Strains, plasmids, and primers used in this study

From: Direct cadaverine production from cellobiose using β-glucosidase displaying Escherichia coli

Strain, plasmid, or primer Relevant phenotype, description, or sequence (5′-3′) Source or reference
Escherichia coli   
NovaBlue endA1 hsdR17 (rK12- mK12+) supE44 thi-1 recA1 gyrA96 relA1 lac[F’ proAB+ lacIqZΔM15::Tn10 (Tetr)]; host for DNA manipulation Novagen
JCM20137   National Institute of Genetics, Japan
Japan Collection of Microorganisms, RIKEN BRC
Jm-cadA JCM20137 strain harboring pHLA-cadA vector This study
Jm-blc-Tfu JCM20137 strain harboring pHLA-blc-Tfu vector This study
Jm-cadA-blc-Tfu JCM20137 strain harboring pHLA-cadA-blc-Tfu vector This study
Genomic DNA   
Thermobifida fusca YX ATCC BAA-629D-5 ATCC
pHLA Cell surface display vector containing pgsA gene under HCE promoter control, ampicillin resistance marker Tanaka et al. 2011
pHLA-cadA Vector for CadA expression This study
pHLA-blc-Tfu Vector for BGL (Tfu0937 from T. fusca) expression using blc anchor protein Tanaka et al. 2011
pHLA-cadA-blc-Tfu Vector for CadA and BGL (Tfu0937 from T. fusca) coexpression using blc anchor protein This study
Oligonucleotide primers   
CadA_F agcagatctgatgaacgttattgcaatattgaatcacatggggg  
CadA-FLAG_R ccagtcgacttatttatcgtcatcatctttataatcttttttgctttcttc  
HCE-blc-Tfu-term_F cgccgtagcgccgatggtagtgtggggtctccccatgcgag  
HCE-blc-Tfu-term_R ggagagatcgcggccgccatggggtcaggtgggaccaccgcgctac  
pHLA-cadA_F gcggccgcgatctctccttcacagattcccaatctcttgtt  
pHLA-cadA_R ctcgcatggggagaccccacactaccatcggcgctacggcg