Skip to main content

Table 1 PCR primers for detection of rumen bacteria

From: Comparative evaluation of rumen metagenome community using qPCR and MG-RAST

Target bacterium Primer Product
  Forward primer Reverse primer Size(bp)
Total bacteria CCTACGGGAGGCAGCAG ATTACCGCCGCTGTTGG 194
Prevotella bryantii ACTGCAGCGCGAACTGTCAGA ACCTTACGGTGGCAGTGTCTC 540
Fibrobacter succinogenes GGTATGGGATGAGCTTGC GCCTGCCCCTGAACTATC 445
Ruminococcus flavefaciens GGACGATAATTGACGGTACTT GCAATCYGAACTGGGACAAT 520
Selenomonas ruminantium TGCTAATACCGAATGTTG TCCTGCATCAAGAAAGA 513
Methanomicrobiales ATCGRTACGGGTTGTGGG CACCTAACGCRCATHGTTTAC 506