Skip to main content

Table 1 Oligonucleotides used during the study

From: Characterization of erythrose reductases from filamentous fungi

Name Sequence (5′ - 3′) a Usage
err1_A.nig_BamHI_f ATATAGGATCC ATGTCTCTCGGAAAGAAGGTTACTCTC pGEX-err1A
err1_A.nig_NotI_r TATATGCGGCCGC TTAAACAATCACCTTATGACCAGCAGGC pGEX-err1A
err1_T.ree_BamHI_f ATATAGGATCC ATGTCTTCCGGAAGGACC pGEX-err1T
err1_T.ree_NotI_r TATATGCGGCCGC TTACAGCTTGATGACAGCAGTG pGEX-err1T
err1_F.gra_BamHI_f ATATAGGATCC ATGTCTTTCGGTCGAACTGTCACTC pGEX-err1F
err1_F.gra_NotI_r TATATGCGGCCGC TTACAGCTTGAGAACAACCTGGTGG pGEX-err1F
err1_XbaI_f ATATATCTAGA ATGTCTTCCGGAAGGACC Vector construction for fungal transformation
err1_Nsi_r TATATATGCAT TTACAGCTTGATGACAGCAGTG
qerr1_f CTTTACCATTGAGCACCTCGACG RT-qPCR err1
qerr1_r GGTCTTGCCCTGCTTCTTGG RT-qPCR err1
qact1_f TGAGAGCGGTGGTATCCACG RT-qPCR act1
qact1_r GGTACCACCAGACATGACAATGTTG RT-qPCR act1
qsar1_f TGGATCGTCAACTGGTTCTACGA RT-qPCR sar1
qsar1_r GCATGTGTAGCAACGTGGTCTTT RT-qPCR sar1
  1. a restriction enzyme sites are given in bold letters.