Skip to main content

Table 1 Sequences of primers used in this study

From: Evaluation of the inhibitory effects of chloroform on ortho-chlorophenol- and chloroethene-dechlorinating Desulfitobacterium strains

Primer name Sequence (5′-3′) Reference
DdehalogF1 GCACTAATACTTGTGTATGTATTCC This study
DdehalogR1 GACCACTGCAATGAGTG This study
DdehalogF2 ATGAACCGCAGAAGCTTTCTG This study
DdehalogR2 GGAACCAGGAATCTTCCTTG This study
DCB2F1 CATGAACCGCAGAAGCTTTC This study
DCB2R1 CAATGGTCTCCGTACCATAGC This study
  1. The sequences of GenBank accession numbers AF115542 and AY013365 were used for primer design.