Skip to main content

Table 1 The sequence of primers and the expected size of the amplified products.

From: Identification of mosquito larvicidal bacterial strains isolated from north Sinai in Egypt

Primer Sequence Length meres Standard Product size
BinA 5'ATGAGAAATTTGGATTTTATT 3' 21 1593 M 1.1 kb
  5'TTAGTTTTGATCATCTGTAAT 3' 21 1593 M  
BinB 5'ATGTGCGATTCAAAAGACAAT3' 21 1593 M 1.3 kb
  5'TCACTGGTTAATTTTAGGTA 3' 20 1593 M  
Mtx1 5'ATGGCTATAAAAAAAGTATTA3' 21 1593 M 2.6 kb
  5'TACTATCTAGGTTCTACACC 3' 20 1593 M