Skip to main content

Table 1 The sequence of primers and the expected size of the amplified products.

From: Identification of mosquito larvicidal bacterial strains isolated from north Sinai in Egypt

Primer

Sequence

Length meres

Standard

Product size

BinA

5'ATGAGAAATTTGGATTTTATT 3'

21

1593 M

1.1 kb

 

5'TTAGTTTTGATCATCTGTAAT 3'

21

1593 M

 

BinB

5'ATGTGCGATTCAAAAGACAAT3'

21

1593 M

1.3 kb

 

5'TCACTGGTTAATTTTAGGTA 3'

20

1593 M

 

Mtx1

5'ATGGCTATAAAAAAAGTATTA3'

21

1593 M

2.6 kb

 

5'TACTATCTAGGTTCTACACC 3'

20

1593 M