Table 1 The sequence of primers and the expected size of the amplified products.
From: Identification of mosquito larvicidal bacterial strains isolated from north Sinai in Egypt
Primer | Sequence | Length meres | Standard | Product size |
|---|---|---|---|---|
BinA | 5'ATGAGAAATTTGGATTTTATT 3' | 21 | 1593 M | 1.1 kb |
| Â | 5'TTAGTTTTGATCATCTGTAAT 3' | 21 | 1593 M | Â |
BinB | 5'ATGTGCGATTCAAAAGACAAT3' | 21 | 1593 M | 1.3 kb |
| Â | 5'TCACTGGTTAATTTTAGGTA 3' | 20 | 1593 M | Â |
Mtx1 | 5'ATGGCTATAAAAAAAGTATTA3' | 21 | 1593 M | 2.6 kb |
| Â | 5'TACTATCTAGGTTCTACACC 3' | 20 | 1593 M | Â |