Skip to main content

Table 2 Primers used in this study

From: Contributions of mutations in acrR and marR genes to organic solvent tolerance in Escherichia coli

Primer Sequence (5 to 3) Positionsa
acrR-F AAACCCATTGCTGCGTTTAT − 90 to − 71 bp of acrR
acrR-R AAACCGCAAGAATATCACGA + 711 to + 730 bp of acrR
marR-F CTGTTCATGTTGCCTGCCAG − 321 to − 302 bp of marR
marR-R CAGTCCAAAATGCTATGAATGG + 482 to + 503 bp of marR
soxR-F TTTCTGATGGGACATAAATCTGCC − 100 to − 77 bp of soxR
soxR-R TGTGTTGACGTCGGGGGAAA + 537 to + 556 bp of soxR
acrA-F CCAATTTGAAATCGGACACTCG − 32 to − 11 bp of acrA
acrA-R GCATGTCTTAACGGCTCCTG + 1200 to + 1219 bp of acrA
acrR-rpsL-neo-F GCTTCAGGATAATCCCGCTAACTTGAGGACGAACTTCTGCGATCCGGTAG GGCCTGGTGATGATGGCGGGATCG − 376 to − 327 bp of acrR (indicated by italics),and − 138 to − 115 bp of rpsL in the rpsL-neocassette (underlined)
acrR-rpsL-neo-R GCGATCGATTTTATCGAGGGTGGCTAATGTATCTGTCAGATCCTGCTGCA TCAGAAGAACTCGTCAAGAAGGCG + 974 to + 1023 bp of acrR (indicated by italics),and + 750 to + 773 bp of neo in the rpsL-neocassette (underlined)
marR-rpsL-neo-F AAACCGATAAACGCGACGATTAAGCCGCCTGCAATTCGCAGACCGGGAAT GGCCTGGTGATGATGGCGGGATCG − 477 to − 428 bp of marR (indicated by italics),and − 138 to − 115 bp of rpsL in the rpsL-neocassette (underlined)
marR-rpsL-neo-R AAGAGAATAAGCGCAGCTGCTATTGCGGATGAAAGTGGTTTCATGATTGC TCAGAAGAACTCGTCAAGAAGGCG + 863 to + 912 bp of marR (indicated by italics),and + 750 to + 773 bp of neo in the rpsL-neocassette (underlined)
Repair-acrRIS-F TGATCGTACTCTTGCTTACTGAT − 575 to − 553 bp of acrR
Repair-acrRIS-R ATCGTTTTGTGCGTTTTGCAAAT + 1202 to + 1224 bp of acrR
Repair-marR-F TTTTCGCCTCCGGTGAATCA − 527 to − 508 bp of marR
Repair-marR-R AACTGGCTGCGTGGTTTGTT + 933 to + 952 bp of marR
  1. aThe positions of the primers are relative to the start codon of each gene.