Skip to main content

Table 1 Oligonucleotides used in this study

From: Engineering of acetyl-CoA metabolism for the improved production of polyhydroxybutyrate in Saccharomyces cerevisiae

No. Sequence (5' -3')
1 TACAATTG CTATTATTATCCTGCTCAGTGGTACTT
2 TCCAATTG TCAGTGAGCGAGGAAGCGGAAGAG
3 TTCGTTCTTCCTTCTGTTCGGAGATTAC
4 GGAACAGGAGTATTGCCTTTCAAGTAGTTATC
  1. Restriction sites are underlined.