Skip to main content

Advertisement

Table 2 Oligonucleotides used for the plasmid constructions

From: Simultaneous production of isopropanol, butanol, ethanol and 2,3-butanediol by Clostridium acetobutylicum ATCC 824 engineered strains

Primers                         Sequence (5’-3’)
thlp-for GCATGCGAATTTAGAATGAAGTTTCTTATGCA
thlp_rev AAAA GGGCCCCCATAGTTTATCCCTAATTTATACG
thlg_rev CTCTGTAGAACTAGTTTATAATTCTACAGAGTTATTTTTAAC
s-adh-for TTTT GGGCCCTTAGACTATTAAAGGAATATTTTTAAGG
s-adh-rev TTTTCTCGAG GTATAATCCTCCATGATCTATTATG
ctfAB for CAACTACTCGAGA TAATTTTTCT AG AGAATTTAAAAGGAGG GATTAAAATG
ctfAB rev AATGGTACTAG TTATTTTTTGTCG AC TGTTTCATAGTATTTC TTTCTAAACAGCC
adc for AAACAACTC GA GTTATAATC TAG ATATAAATAAATAGGA CTAGAGG CG
adc rev AAAAATACT AGTTACCATTTAAGTC GACTCTTATTTTTATTA CTTAAG
  1. Bases not complementary with genomic DNA are in italics;
  2. Added restriction sites (ApaI, SalI, speI, SphI, XbaI and XhoI,) are underlined;
  3. Ribosome binding sites are in bold.