Skip to main content

Advertisement

Table 2 List of primers used in this study a

From: Revelation of the ability of Burkholderi a sp. USM (JCM 15050) PHA synthase to polymerize 4-hydroxybutyrate monomer

Primer pairs Primers’ sequences Target gene
І F: GCGAGTCACCGAAAATGTTTTATGTT Burkholderia sp. phaC gene
R: TGCGGCCCCTTCAGGTAGTTGTC
ІІ F: AAGAAGAAGCGCAGCTACTGGGTC Burkholderia sp. phaA gene
R: TTGAACAGGCTCGTCAGATTGGTG
ІІІ F: GGCCAGACCAACTATTCGACCGC Burkholderia sp. phaB and phaR genes
R: GCGACGGCCTTACTTCTTTTCCG
IV F: GCGAGGATC CGAAAATGTTTTATGTT Burkholderia sp. phaC gene
  R: ATGAGCTC ACTACGTCCGTCATTTCC  
V F: GCGAGGATC CGAAAATGTTTTATGTT Burkholderia sp. phaC gene
  R: ATGAATTC ACTACGTCCGTCATTTCC
  1. a All primers were synthesized by 1st BASE Laboratory (Malaysia). Restriction enzymes digestion sites were underlined.