Skip to main content

Table 2 List of primers used in this study a

From: Revelation of the ability of Burkholderi a sp. USM (JCM 15050) PHA synthase to polymerize 4-hydroxybutyrate monomer

Primer pairs Primers’ sequences Target gene
ІІІ F: GGCCAGACCAACTATTCGACCGC Burkholderia sp. phaB and phaR genes
  1. a All primers were synthesized by 1st BASE Laboratory (Malaysia). Restriction enzymes digestion sites were underlined.