Skip to main content

Table 2 Oligonucleotide primers designed and used in this study

From: Branching of the p-nitrophenol (PNP) degradation pathway in burkholderia sp. Strain SJ98: Evidences from genetic characterization of PNP gene cluster

Target ORF Primer name Primer sequence (5’ → 3’) Application/purpose
PnpE1 pnpE1_F GGGGACAAGTTTGTACAAAAAAGCAGGCTTAATGGGCCGACATCTGCAT HqD Large subunit amplification
  pnpE1_R GGGGACCACTTTGTACAAGAAAGCTGGGTATTAGAACGCGACCGGATA  
PnpE2 pnpE2-F GGGGACAAGTTTGTACAAAAAAGCAGGCTTAATGGAGACAGACATGCAA HqD Small subunit amplification
  pnpE2-R GGGGACCACTTTGTACAAGAAAGCTGGGTATTACTGGATGCAGATGTC  
PnpE1 pnpE1-RT_F TCTACGGCTGGGTCAATTTC HqD large subunit RT-PCR primer
  pnpE1-RT_R CTTCGTTCACCCAGTCCTTC  
PnpE2 pnpE2-RT_F CGCATTACGTGATGTCCAAC HqD Small subunit RT-PCR primer
  pnpE2-RT_R GTTTCACCGAGCCTTCGATA  
PnpD HqD_F AGGAGTTCATCCTGCT(G/C)(A/T)G Partial BtD gene amplification
  HqD_R CGCAC(GC)CCGAACAC(A/T)GCGTC