Skip to main content

Table 3 Primers used in this study

From: Examination of PHB Depolymerases in Ralstonia eutropha: Further Elucidation of the Roles of Enzymes in PHB Homeostasis

Name/purpose Sequence(5’-3’)*
Deletion of phaZ3 gene
phaZ3del1 CAT AGA GCT C AT CGC TGC GGC AAC TTG GG
phaZ3del2 GAC ACT GCA G CA TGA AGA CTC CCG TAG GAA
phaZ3del3 GAT ACT GCA G AC TTA GCA TCG CCT GCC C
phaZ3del4 CAA GTC TAG A GA CGC GTG AAC AAG CTG
phaZ3delchkFW CGG TGA ACC ATC GAA TTC
phaZ3delchkRV CAA GGT TGA CCG CAG CAA G
Plasmid-based overexpression of phaZ genes
PhaZ1 FW GCA CGG TAC C AT GCT CTA CCA ATT GCA TGA G
Pha Z1 RV GAT ATC TAG A TT ACC TGG TGG CCG AGG CCT G
Pha Z2 FW CAT AGG TAC C AT GCT GTA CCA CGC CTA CCA
Pha Z2 RV GCG TTC TAG A TT AGC TGC TGG TGT AGA TGG
Pha Z3 FW CTA TGT CGA C AT GCT GTA CCA GCT CGT CGA G
Pha Z3 RW CAA GTC TAG A CT AAG TAT CGT GCC CGG TCA
Pha Z5 FW AAT TGG TAC C AT GGC GCT CTA TGC TCT GCG
Pha Z5 RW GAA TTC TAG A TC AGT CGG CGC ACC GTT GAA
RT-PCR to quantify overexpression of phaZ genes
PhaZ1 FW CCATCAAGCTGCTCAAGGAT
Pha Z1 RV CCAGTCGGTGACGTAGACCT
Pha Z2 FW TCTACCTGGAAACCGTCAGC
Pha Z2 RV CAGATATCGTCGCGTTCACC
Pha Z3 FW GGACTATTGCCTGGATCTCG
Pha Z3 RV AATTCCTGGAACACGAGCTG
Pha Z5 FW ATGATCGAGGCAGGTTATCG
Pha Z5 RV GACCTCGTCGATCTCAAAGC
  1. *Restriction sites indicated in bold.