Skip to main content

Table 1 Oligonucleotide primers used in this study for either PCR-amplification or DNA sequencing

From: Construction of a novel Pichia pastoris strain for production of xanthophylls

Primer name Primer sequence (5′-3′) Application
Aa-crtW Forward 5′ AACTATTTCGAAACGATGG CACATGCCCTGCC 3′ PCR
Aa-crtW Reverse 5′GGAATTC TCAGCGGTGCCCCC 3′ PCR
Aa-crtZ Forward 5′ AACTATTTCGAAACGATGG CAAATTTCCTGATCG 3′ PCR
Aa-crtZ Reverse 5′ GGAATT CTCACGTGCGCTCCTGC 3′ PCR
pGAP Forward 1 5′ GTCCCTATTTCAATCAATGAA 3′ Sequencing
pGAP Forward 2 5′ AGATCTTTTTTGTAGAAATGTC 3′ Sequencing
AOX-1 Reverse 5′ GCAAATGGCATTCTGACATCC 3′ Sequencing