Skip to main content

Table 2 Primers used in this study

From: SimReg1 is a master switch for biosynthesis and export of simocyclinone D8 and its precursors

Primer Nucleotide sequence (5'-3') Purpose Gene name
SSR1F ATACCATGGCCCGTGAACGT SimReg1 simReg1
SSR1R TTTGAATTCATTAATGGTGATGGT purification  
SR1D4F TAGAATTCGTGAGCAGATCATGT DNA-shift assay P D4
SR1D4R TAGAATTCCATTGTGAACCATC   
SD2R1F TAGAATTCATCGCCACGACCATG DNA-shift assay P R1
SD2R1R TAGAATTCCGCGGTTCGGCAGA   
simX5D3F TAGAATTCTGTACAAGGCCTGGT DNA-shift assay P D3
simX5D3R TAGAATTCGCGACAGGAGCCATA   
simEXX4F TAGAATTCGACGCCTTCCAGTC DNA-shift assay P X4
simEXX4R TAGAATTCTCAGAACATCGTCC   
SR2ExXF AAATCTAGATCAAGCCAGTGCTG DNA-shift assay P R2Ex
SR2ExXR TTTGAATTCTTGACCACCACTTC   
PSR2F TCGACGAGGTCCTCTTTG DNA-shift assay P SR2
PSR2R TCGTATTCATACACCGTAC   
PEx1F CCAATTGCGCTACGCTCCT DNA-shift assay P SEx1
PEx1R CCATGTAGGCGGTGACGA   
simA7F TAAAGCTTCAAAACGGGGTGAAC DNA-shift assay P A7
simA7R ATAAGCTTGTCGATACCGATCTTC   
PEx2F ACTTCCCAGAAGTA DNA-shift assay P Ex2
PEx2R AGAGGGCAGTAGAC   
PR3F TTTCTAGATGCACCCGATCCTC DNA-shift assay P SR3
PR3R GAACAGGATTCGCATGAGTACT   
D4For TATTGGTCGCGCAGTCGTCC DNA-shift assay part of the simD4 gene
D4Rev TTGTCCTGCATCATGACGAG   
simD4_for_script AAATCTAGAGGCGACCGACCCCG
GCCGAG
simD4 promoter cloning P D4
simD4_rev_script AAAGGTACCCGATCCGGCTGGCA
TTACTG
  
simReg1_for AAAAAGCTTTACCTGTATCCAGGGC
GGGCACTT
simReg1 cloning simReg1
simReg1_ rev AAAGGATCCGCACAAAGCGGCAGC
AATCG